View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18156_high_61 (Length: 234)

Name: NF18156_high_61
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18156_high_61
NF18156_high_61
[»] chr2 (1 HSPs)
chr2 (183-233)||(16648068-16648118)


Alignment Details
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 16648118 - 16648068
Alignment:
Q  183 ccaaaagtgcatcttggagagccactaagaattgaagttcatgcactcaga 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16648118 ccaaaagtgcatcttggagagccactaagaattgaagttcatgcactcaga 16648068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University