View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18156_high_55 (Length: 237)

Name: NF18156_high_55
Description: NF18156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18156_high_55
NF18156_high_55
[»] chr2 (1 HSPs)
chr2 (89-222)||(16648121-16648254)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 89 - 222
Target Start/End: Original strand, 16648121 - 16648254
Alignment:
Q  89 acaatggttacaatggagctgagcaatactcaagagatcatttcttaatcctggcaagtagtataatcagtgatgacttgatcaatcttaattgattatg 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  16648121 acaatggttacaatggagctgagcaatactcaagagatcatttcttaatcctggcaagtagtataatcagtgatgacttgatcaatcttaattaattatg 16648220  T
Q  189 aaaggtaattgattatgaaacctttcacttttct 222  Q
    ||||||||||||||||||||||||||||||||||    
T  16648221 aaaggtaattgattatgaaacctttcacttttct 16648254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University