View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18155_low_9 (Length: 345)

Name: NF18155_low_9
Description: NF18155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18155_low_9
NF18155_low_9
[»] chr7 (1 HSPs)
chr7 (49-306)||(1288037-1288275)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 49 - 306
Target Start/End: Original strand, 1288037 - 1288275
Alignment:
Q  49 atttatatatcgtttggaattcattccaactaatcaattattctgggagccagttgatgatgcaaccctattaacatcgttatggagggttatccttata 148  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1288037 atttatatatcgtttggaattcattccaactaatcaatgattctgggagccagttgatgatgcaaccctattaacatcgttatggagggttatccttata 1288136  T
Q  149 cgtggtggaggagaaaatgggcagatagagaagttgagcagagattggatagaacgacggtcatggacagatggctctgttcgaacaccaagtgtgtttg 248  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                   ||| ||||||||||||||||||    
T  1288137 cgtggtggaggagaaaatgggcagatagagaagttgagcagagattggatagaacgacg-------------------gttggaacaccaagtgtgtttg 1288217  T
Q  249 tgtgaattgaaaaattactatgtcccatatcaggtagattatacacacaatattagtg 306  Q
    ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||    
T  1288218 tgtgaattgaaaaattattatgtcccatatccggtagattatacacacaatattagtg 1288275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University