View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18152_low_8 (Length: 223)

Name: NF18152_low_8
Description: NF18152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18152_low_8
NF18152_low_8
[»] chr3 (1 HSPs)
chr3 (14-134)||(43918188-43918308)
[»] chr8 (1 HSPs)
chr8 (64-116)||(39128772-39128824)


Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 14 - 134
Target Start/End: Original strand, 43918188 - 43918308
Alignment:
Q  14 cataggcaggatatatattcgatgacacgaggagtgcaacaggagctaacatttatattacctgcaacatctcaacaagaagaataatgcgctcagcatg 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43918188 cataggcaggatatatattcgatgacacgaggagtgcaacaggagctaacatttatattacctgcaacatctcaacaagaagaataatgcgctcagcatg 43918287  T
Q  114 cttacggcaatttagacttaa 134  Q
    |||||||||||||||||||||    
T  43918288 cttacggcaatttagacttaa 43918308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 64 - 116
Target Start/End: Complemental strand, 39128824 - 39128772
Alignment:
Q  64 atttatattacctgcaacatctcaacaagaagaataatgcgctcagcatgctt 116  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  39128824 atttatattacctgcaacatctcaacaagaagaataatacgctcagcatgctt 39128772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University