View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18145_high_5 (Length: 213)

Name: NF18145_high_5
Description: NF18145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18145_high_5
NF18145_high_5
[»] chr1 (2 HSPs)
chr1 (93-166)||(14881230-14881303)
chr1 (164-194)||(14881393-14881423)
[»] chr3 (1 HSPs)
chr3 (98-164)||(10671583-10671650)


Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 93 - 166
Target Start/End: Original strand, 14881230 - 14881303
Alignment:
Q  93 cacataaagtctttcagaagctgcaaaattcttacgctaattcacattataatagattacttcaacattgatgc 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  14881230 cacataaagtctttcagaagctgcaaaattcttacgctaattcacattataatagatcacttcaacattgatgc 14881303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 194
Target Start/End: Original strand, 14881393 - 14881423
Alignment:
Q  164 tgcggggaaaacaaatatggaattgaaggtt 194  Q
    |||||||||||||||||||||||||||||||    
T  14881393 tgcggggaaaacaaatatggaattgaaggtt 14881423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 164
Target Start/End: Original strand, 10671583 - 10671650
Alignment:
Q  98 aaagtctttcagaagctgcaaaattcttacg-ctaattcacattataatagattacttcaacattgat 164  Q
    |||||| |||| ||| ||||||||||||||| |||| |||||||||||||||||| || |||| ||||    
T  10671583 aaagtccttcaaaagttgcaaaattcttacgcctaagtcacattataatagattatttaaacactgat 10671650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University