View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18140_low_25 (Length: 216)

Name: NF18140_low_25
Description: NF18140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18140_low_25
NF18140_low_25
[»] chr5 (1 HSPs)
chr5 (19-197)||(5475621-5475799)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 5475621 - 5475799
Alignment:
Q  19 caatatttataaattgtctatttttatattggttgtttatagttgttgaattttagatgttcaaataagattgnnnnnnncaaaaatatatttaacggta 118  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||       ||||||||| || || ||||    
T  5475621 caatatttataaatcgtctatttttatattggttgtttatagttgttgatttttagatgttcaaataagattgttcttttcaaaaatatcttcaatggta 5475720  T
Q  119 gttaactatttttcgttgctgaacaagagttaactaccgtttaatgcaaggtggtaaatgtgttcaaaagttgcaagcc 197  Q
    |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| ||||||| ||||||||||    
T  5475721 gttaactatttttcgttgctgaacgagagttaactaccgtttagtgcaaggtggtaaatgcgttcaaatgttgcaagcc 5475799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University