View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18133_low_7 (Length: 258)

Name: NF18133_low_7
Description: NF18133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18133_low_7
NF18133_low_7
[»] chr5 (2 HSPs)
chr5 (111-240)||(29092677-29092806)
chr5 (9-77)||(29092803-29092871)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 111 - 240
Target Start/End: Complemental strand, 29092806 - 29092677
Alignment:
Q  111 caagtcattggttcttgatctgctctcatgatcagtgcttctcattaccatgttatttctctctaactttacaagaaaaatttgtgattctttgctggca 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29092806 caagtcattggttcttgatctgctctcatgatcagtgcttctcattaccatgttatttctctctaactttacaagaaaaatttgtgattctttgctggca 29092707  T
Q  211 ttacttcattttagtgcccatgtctttggt 240  Q
    ||||||||| | ||||||||||||||||||    
T  29092706 ttacttcatatcagtgcccatgtctttggt 29092677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 29092871 - 29092803
Alignment:
Q  9 gattatactgcaaataacttactattttgttaatttattccaaagnnnnnnnattggagtatttacaag 77  Q
    ||||| |||||||||||||| ||||||||||||||||||||||||       |||||||||||||||||    
T  29092871 gattacactgcaaataactttctattttgttaatttattccaaagtttttttattggagtatttacaag 29092803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University