View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18130_low_22 (Length: 237)

Name: NF18130_low_22
Description: NF18130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18130_low_22
NF18130_low_22
[»] chr1 (1 HSPs)
chr1 (1-217)||(38284120-38284340)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 38284120 - 38284340
Alignment:
Q  1 cgatggcattgatgatacgaaacttaaaattatagaacactttaaaatttggatatttaggaaatacgannnnnnnn---atagataaatcttacaatgt 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||    
T  38284120 cgatggcattgatgatacgaaacttaaaattatagaacactttaaaatttggatatttaggaaatacgatttttttttttatagataaatcttacaatgt 38284219  T
Q  98 tagtaattatattagttttcgagaatcaaaaccggatacctcttttttcaaactctttcagcgtcgcttacctcattaacctattttagc-ggggatgaa 196  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||    
T  38284220 tagtaattatattagtttccgagaatcaaaaccggatacctcttttttcaaactctttcggcgtctcttacctcattaacctattttagcgggggatgaa 38284319  T
Q  197 tgaaaattctagtcacatagt 217  Q
    |||||||||||||||||||||    
T  38284320 tgaaaattctagtcacatagt 38284340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University