View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18129_high_14 (Length: 225)

Name: NF18129_high_14
Description: NF18129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18129_high_14
NF18129_high_14
[»] chr7 (1 HSPs)
chr7 (16-206)||(7905643-7905832)


Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 7905643 - 7905832
Alignment:
Q  16 ggaggatctacaaatatccatgttccagttgcttccaaagcactaaagctcaggagacatagcaagttgccaacgtggatcactttgggcctgtttaaaa 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  7905643 ggaggatctacaaatatccatgttccagttgcttccaaagcactaa-gctcaggggacatagcaagttgccaacgtggatcactttgggcctgtttaaaa 7905741  T
Q  116 gaagaaggttcaatgtctgatgagatggcaagagtgaagctacaatatgagggagataacgggtgataagacaaggaagcggagatgggaa 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7905742 gaagaaggttcaatgtctgatgagatggcaagagtgaagctacaatatgagggagataacgggtgataagacaaggaagcggagatgggaa 7905832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University