View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18128_high_6 (Length: 396)

Name: NF18128_high_6
Description: NF18128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18128_high_6
NF18128_high_6
[»] chr7 (3 HSPs)
chr7 (5-380)||(10320860-10321235)
chr7 (95-257)||(46223393-46223546)
chr7 (259-343)||(46222728-46222812)
[»] chr2 (2 HSPs)
chr2 (98-321)||(39943046-39943267)
chr2 (99-346)||(39943378-39943618)


Alignment Details
Target: chr7 (Bit Score: 312; Significance: 1e-176; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 5 - 380
Target Start/End: Complemental strand, 10321235 - 10320860
Alignment:
Q  5 caacagatgcaacggtgacaatactctcatcaactacaacaactgtagctgtcgttccagacatttctcccttgatactctgaaaatccatgtcagtctt 104  Q
    ||||||||||||| |||||||||||||||||||| |||||||  |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||    
T  10321235 caacagatgcaacagtgacaatactctcatcaacaacaacaaacgtagctgtagttccagacatttctcctttgatactctgaaaatccatgtcagtctt 10321136  T
Q  105 cacaaaaccagccactagagcacgaggaagggcatgtagccaagcatccctgctgctactgataatatcttgcggtattgtcttcaaaacattatttagc 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||  |||||||||||||||||||    
T  10321135 cacaaaaccagccactagagcacgaggaagggcatgtagccaagcatccctgctgctgctgataatatctttcggtatttccttcaaaacattatttagc 10321036  T
Q  205 aagttttcttttgcataaactgcggctgatatgccgctatgcccataaaaaattgcaaatactgaaaatgcagttgatggatccccgggaacccgatggc 304  Q
    |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| || ||||| |||||||||||||||||||||||||| ||||    
T  10321035 aagttttcttttgcataaactgcggctgatataccgctatgcccatcaaaaattgcaaagaccgaaaacgcagttgatggatccccgggaacccggtggc 10320936  T
Q  305 aacatgttttgatcagaccataatcttctcctttcttggtcatgctttcttctccatacttaacaaaccttttttc 380  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10320935 aacatgttttgatcagaccataatcttctcctttcttggtcatgctttcttctccatacttaacaaaccttttttc 10320860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 95 - 257
Target Start/End: Complemental strand, 46223546 - 46223393
Alignment:
Q  95 tgtcagtcttcacaaaaccagccactagagcacgaggaagggcatgtagccaagcatccctgctgctactgataatatcttgcggtattgtcttcaaaac 194  Q
    |||||||||||||||||||| | |||||||| ||||||||||| |||||||| ||||||||||||         |||||||||||||| |   |||||||    
T  46223546 tgtcagtcttcacaaaaccaacaactagagcgcgaggaagggcctgtagccatgcatccctgctg---------atatcttgcggtatcgcactcaaaac 46223456  T
Q  195 attatttagcaagttttcttttgcataaactgcggctgatatgccgctatgcccataaaaaat 257  Q
    |||||| |||||||||||||||| |||||  || |||||||| ||| | ||||| | ||||||    
T  46223455 attattaagcaagttttcttttgtataaatagcagctgatataccgttgtgcccgtcaaaaat 46223393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 343
Target Start/End: Complemental strand, 46222812 - 46222728
Alignment:
Q  259 gcaaatactgaaaatgcagttgatggatccccgggaacccgatggcaacatgttttgatcagaccataatcttctcctttcttgg 343  Q
    ||||| || ||||| || ||||||||||||||||||||||  ||||||  ||||||||| | |   |||||||||||||||||||    
T  46222812 gcaaagacggaaaacgccgttgatggatccccgggaaccctgtggcaatctgttttgattaaaaagtaatcttctcctttcttgg 46222728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 98 - 321
Target Start/End: Original strand, 39943046 - 39943267
Alignment:
Q  98 cagtcttcacaaaaccagccactagagcacgaggaa-gggcatgtagccaagcatccctgctgctactgataatatcttgcggtattgtcttcaaaacat 196  Q
    ||||||||||||||||| |||||||| |  ||| || |||| |||||||| |||||||||||| |   ||||   |||||| ||||||   |||||||||    
T  39943046 cagtcttcacaaaaccaaccactagaacgtgagtaatgggcgtgtagccatgcatccctgctggtgtggata---tcttgctgtattgcagtcaaaacat 39943142  T
Q  197 tatttagcaagttttcttttgcataaactgcggctgatatgccgctatgcccataaaaaattgcaaatactgaaaatgcagttgatggatccccgggaac 296  Q
    |||||||||||||||| ||||||||||  |  |||||| | | | |||||||   ||||||||| || || | ||| |||||||| ||||||| | ||||    
T  39943143 tatttagcaagttttcctttgcataaatagaagctgatgtactgttatgcccgacaaaaattgcgaagacagtaaacgcagttgaaggatcccagagaac 39943242  T
Q  297 ccgatggcaacatgttttgatcaga 321  Q
    ||  ||||||  |||||||||||||    
T  39943243 cctgtggcaatctgttttgatcaga 39943267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 99 - 346
Target Start/End: Complemental strand, 39943618 - 39943378
Alignment:
Q  99 agtcttcacaaaaccagccactagagcacgaggaagggcatgtagccaagcatccctgctgctactgataatatcttgcggtattgtcttcaaaacatta 198  Q
    |||||| |||||||||  ||||||||| | || |||| |||||||||| ||||||||    || ||| ||||||||||||||||||   ||||  | | |    
T  39943618 agtcttaacaaaaccaaacactagagcgcaagtaaggtcatgtagccatgcatccct----ct-ctgctaatatcttgcggtattgcactcaa--cttaa 39943526  T
Q  199 tttagcaagttttcttttgcataaactgcggctgatatgccgctatgcccataaaaaattgcaaatactgaaaatgcagttgatggatccccgggaaccc 298  Q
    ||| |||||||||  ||||||||||  || |||||| | | | ||||||||| |||||  ||||| || | ||  |||||||||||||||||| ||||||    
T  39943525 ttttgcaagtttttctttgcataaatagcagctgatgtactgttatgcccatgaaaaaccgcaaagacagcaaccgcagttgatggatccccgagaaccc 39943426  T
Q  299 gatggcaacatgttttgatcagaccataatcttctcctttcttggtca 346  Q
       |||||  ||||||||| | |   ||||||||||||||||||||||    
T  39943425 tgaggcaatctgttttgattaaatagtaatcttctcctttcttggtca 39943378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University