View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18122_low_17 (Length: 231)

Name: NF18122_low_17
Description: NF18122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18122_low_17
NF18122_low_17
[»] chr2 (1 HSPs)
chr2 (20-199)||(14748437-14748616)


Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 14748437 - 14748616
Alignment:
Q  20 tcttgctcattgatttcttcgaaatatttcttttagtaaaataataagaccttattaatgtcgtgtaatagatatacccataaaatatttcaagggatct 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14748437 tcttgctcattgatttcttcgaaatatttcttttagtaaaataataagaccttattaatgtcgtgtaatagatatacccataaaatatttcaagggatct 14748536  T
Q  120 aaattcttcataccaaatttgtagtacaatttaggcatgatgggttggtggagagtatcagaagacaagacaagaataat 199  Q
    ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14748537 aaattcttcataccaaatttggaatacaatttaggcatgatgggttggtggagagtatcagaagacaagacaagaataat 14748616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University