View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18121_low_16 (Length: 287)

Name: NF18121_low_16
Description: NF18121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18121_low_16
NF18121_low_16
[»] chr1 (1 HSPs)
chr1 (22-268)||(37049293-37049539)


Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 22 - 268
Target Start/End: Original strand, 37049293 - 37049539
Alignment:
Q  22 ataacattactgtaaagataaagaacaaaaccagatccagttgcagccaagacaagacaatctctatgatcaatccaagcagagagagcttccttctgaa 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37049293 ataacattactgtaaagataaagaacaaaaccagatccagttgcagccaagacaagacaatctctatgatcaatccaagcagagagagcttccttctgaa 37049392  T
Q  122 aacttttcaacgatgaaaaaccaaaatgcttttgcaacaaaatgctagctttttgctgccaatcagatgcaacatcgatagcatgagctacaccggaatc 221  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||    
T  37049393 aacttttcaaagatgaaaaaccaaaatgcttttgcaacaaaatgctagctttttgctgccaatcagatgcaacatcgatagcatgagctactgcggaatc 37049492  T
Q  222 atgatcaaatcccattcgcggtaagaactctttctccttgtgctctt 268  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  37049493 atgatcaaatcccattcgcggtaagaactctttctccttgtgctctt 37049539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University