View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18121_high_21 (Length: 228)

Name: NF18121_high_21
Description: NF18121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18121_high_21
NF18121_high_21
[»] chr5 (1 HSPs)
chr5 (36-212)||(8676704-8676880)


Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 36 - 212
Target Start/End: Original strand, 8676704 - 8676880
Alignment:
Q  36 caaatcaccatgtaaccacttgaaggattccatgaaaccatttgttttctgaaaaagatctatgatgaaaaacggattgtgtgttttgtgagcaaaggat 135  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  8676704 caaatcaccatgtaaccacttgaaggattccatgaaaccatttgttttctgaaaaagatctatgatgaaaaacggattgtgtgttttgtgagtaaaggat 8676803  T
Q  136 tgtcttctcacaaaggagagaaaattatcttctcagaggagagaaaaaattccacttccacttattaatcaagtttt 212  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  8676804 tgtcttctcacaaaggagagagaattatcttctcagaggagagaaaaaattccacttccacttattaataaagtttt 8676880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University