View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1811_low_3 (Length: 249)

Name: NF1811_low_3
Description: NF1811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1811_low_3
NF1811_low_3
[»] chr1 (1 HSPs)
chr1 (1-233)||(24868568-24868799)


Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 24868799 - 24868568
Alignment:
Q  1 atactctgggcttgtaggtttcagttctaaatcaaatt-gtaaattgactgaaaaactacttctagctaatatcttttgttactgtaatctgttccataa 99  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24868799 atactctgggcttgtaggtttcagttctaaatcaaatttgtaaattgactgaaaaactacttctagctaatatcttttgttactgtaatctgttccataa 24868700  T
Q  100 ttcttcaaattgaacactattttcttgcatacagtttttcgtgagatctcttcaaaaatatttacaaataacactacaattgcaggctttaactttaaca 199  Q
    |||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||    
T  24868699 ttcttcaaattgaacattattttcttgcatacagttttttgtgagatctcttcaaaaatatttacaaataacact--aattgcaggctttaactttaaca 24868602  T
Q  200 ttaacattaaagacaagcataatccagaagattc 233  Q
    ||||||||||||||||||||||||||||||||||    
T  24868601 ttaacattaaagacaagcataatccagaagattc 24868568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University