View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18116_low_4 (Length: 330)

Name: NF18116_low_4
Description: NF18116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18116_low_4
NF18116_low_4
[»] chr4 (1 HSPs)
chr4 (16-324)||(29958509-29958817)


Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 16 - 324
Target Start/End: Complemental strand, 29958817 - 29958509
Alignment:
Q  16 tcagcaaaagatgatgtcctttctggcaaaggccatgaatagtccgggctttatggctcaattttcacagcagcagaatgaaagtaatagacatgttacc 115  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29958817 tcagcaacagatgatgtcctttctggcaaaggccatgaatagtccgggctttatggctcaattttcacagcagcagaatgaaagtaatagacatgttacc 29958718  T
Q  116 gcaggtaaaaagaggcggctccaggggcaggaagaagatagtttagacaccaagaatccccataatcctcttgatggacgtgttgttaagtaccagcctt 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  29958717 gcaggtaaaaagaggcggctccaggggcaggaagaagatagtttagccaccaagaatccccataatcctcttgatgggcgtgttgttaagtaccagcctt 29958618  T
Q  216 cgattaatgaggctgcaaaaacattatttaaccagatgttgcaaatgaacagttctgcaagggtggattcctccatcaagaaccttgatgcattccttat 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29958617 cgattaatgaggctgcaaaaacattatttaaccagatgttgcaaatgaacagttctgcaagggtggattcctccatcaagaaccttgatgcattccttat 29958518  T
Q  316 tgatgatgt 324  Q
    |||||||||    
T  29958517 tgatgatgt 29958509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University