View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18113_low_10 (Length: 250)

Name: NF18113_low_10
Description: NF18113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18113_low_10
NF18113_low_10
[»] chr2 (2 HSPs)
chr2 (151-250)||(7067792-7067891)
chr2 (8-67)||(7067976-7068035)


Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 151 - 250
Target Start/End: Complemental strand, 7067891 - 7067792
Alignment:
Q  151 ctctctgatcacaattccaacctcaaaatcttaactttcaccctctactacccttttcctgattttgcttctagggtttgttcatgttctttgaagtaca 250  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7067891 ctctctgatcacaattccaacctcaaaatcttaactttcatcctctactacccttttcctgattttgcttctagggtttgttcatgttctttgaagtaca 7067792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 67
Target Start/End: Complemental strand, 7068035 - 7067976
Alignment:
Q  8 ccaagaaaatgtctctaccttttccttctttgtgcatttcctctgcatcctagggttatg 67  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7068035 ccaacaaaatgtctctaccttttccttctttgtgcatttcctctgcatcctagggttatg 7067976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University