View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18111_low_23 (Length: 250)

Name: NF18111_low_23
Description: NF18111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18111_low_23
NF18111_low_23
[»] chr7 (2 HSPs)
chr7 (1-89)||(4453762-4453850)
chr7 (155-239)||(4453916-4454000)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 4453762 - 4453850
Alignment:
Q  1 tattaaagacagagatgaccctgacctaggtttaaagattaacattactcttgctcttggacttccttctctttgcaatacaccagata 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4453762 tattaaagacagagatgaccctgacctaggtttaaagattaacattactcttgctcttggacttccttctctttgcaatacaccagata 4453850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 155 - 239
Target Start/End: Original strand, 4453916 - 4454000
Alignment:
Q  155 atcaaagaatttaaatagtgccgtgccatggtacgtacatttcctatataatggtcaacataccctgtcttgaaattgccttctt 239  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4453916 atcaaagaatttaaatagtgccgtgccatggtacgtacatttcctatataatggtcaacataccctgtcttgaaattgccttctt 4454000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University