View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18111_high_23 (Length: 237)

Name: NF18111_high_23
Description: NF18111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18111_high_23
NF18111_high_23
[»] chr3 (1 HSPs)
chr3 (12-222)||(52379366-52379572)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 52379366 - 52379572
Alignment:
Q  12 aagaaaagaagaactaaattcatcatatatgttgtagcaactacaaaatattagcacttgtcatgaaaacttaaccaacattatgcactgcatggatttt 111  Q
    |||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  52379366 aagaaaagaagaactaaattcat---atatgttgtagcaactacaaaatattagcacttgtcatgaaaacttaaccaacattatgtactgcatggatttt 52379462  T
Q  112 ttaagatgatggctttagaatgaaattgattgcataattacctttgctcattgccaaattgccttccattggtgatattgataccagcacctcccctgta 211  Q
     ||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52379463 -taagatgatagctttacaatgaaattgattgcataattacctttgctcattgccaaattgccttccattggtgatattgataccagcacctcccctgta 52379561  T
Q  212 tgttggcagtg 222  Q
    |||||||||||    
T  52379562 tgttggcagtg 52379572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University