View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18110_low_8 (Length: 328)

Name: NF18110_low_8
Description: NF18110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18110_low_8
NF18110_low_8
[»] chr8 (2 HSPs)
chr8 (138-306)||(43054826-43054994)
chr8 (15-62)||(43055070-43055117)


Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 138 - 306
Target Start/End: Complemental strand, 43054994 - 43054826
Alignment:
Q  138 tcgatcgattgatgaaagtacctgagggaaattagcactctgagcccaaacgctaccgtctacaccgaggatagcagcatgagtgagatgattaccttca 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43054994 tcgatcgattgatgaaagtacctgagggaaattagcactctgagcccaaacgctaccgtctacaccgaggatagcagcatgagtgagatgattaccttca 43054895  T
Q  238 atgtcacagagaaggtgatcatcaacataagtttgccacgacatggttcaaagattttctcaggaaaat 306  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43054894 atgtcacagagaaggtgatcatcaacataagtttgccacgacatggttcaaagattttctcaggaaaat 43054826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 15 - 62
Target Start/End: Complemental strand, 43055117 - 43055070
Alignment:
Q  15 cagagatcggaaaatctagaatatttgataaacaaaagaatgaaactc 62  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||    
T  43055117 cagagatcggaaaatctagaataattgataaacaaaagaatgaaactc 43055070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University