View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18110_high_9 (Length: 239)

Name: NF18110_high_9
Description: NF18110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18110_high_9
NF18110_high_9
[»] chr5 (1 HSPs)
chr5 (10-220)||(10838446-10838656)
[»] chr8 (1 HSPs)
chr8 (133-197)||(30349585-30349649)


Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 10838446 - 10838656
Alignment:
Q  10 gagcagagagtagtgatgtgaattgtgacaagttttttgggcaggatcaattggaaatgctgggagaagaacattcagccgcggttcttgtgaaaaggtt 109  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  10838446 gagcaaagagtagtgatgtgaattgtgacaagttttttgggcaggatcaattggaaatgctgggagaagagcattcagccgcggttcttgtgaaaaggtt 10838545  T
Q  110 ggatttttggctttattatattgcatacttctgcggaggtacaattggtcttgtttacagcaataatcttggacagatagctcaatctttaggccacagt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10838546 ggatttttggctttattatattgcatacttctgcggaggtacaattggtcttgtttacagcaataatcttggacagatagctcaatctttaggccacagt 10838645  T
Q  210 tatagaacgtc 220  Q
    |||||||||||    
T  10838646 tatagaacgtc 10838656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 133 - 197
Target Start/End: Complemental strand, 30349649 - 30349585
Alignment:
Q  133 catacttctgcggaggtacaattggtcttgtttacagcaataatcttggacagatagctcaatct 197  Q
    |||||||||| |||||||| ||||||||||| || ||||||||||| |||||||| |||||||||    
T  30349649 catacttctgtggaggtacgattggtcttgtctatagcaataatctgggacagattgctcaatct 30349585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University