View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1810_low_13 (Length: 216)

Name: NF1810_low_13
Description: NF1810
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1810_low_13
NF1810_low_13
[»] chr3 (2 HSPs)
chr3 (107-198)||(37326306-37326397)
chr3 (16-70)||(37326214-37326268)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 107 - 198
Target Start/End: Original strand, 37326306 - 37326397
Alignment:
Q  107 gctattattactgtgttgttaatgatgtttgatcagttattagtagtaatgaagttaaatattggggcaatactagtgcgttagattttcat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37326306 gctattattactgtgttgttaatgatgtttgatcagttattagtagtaatgaagttaaatattggggcaatactagtgcgttagattttcat 37326397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 16 - 70
Target Start/End: Original strand, 37326214 - 37326268
Alignment:
Q  16 cttcgcttctatgatgctcatgttgttgaggttcgtcgttttcttccaaacgccg 70  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37326214 cttcgcttctatgatgctcatgttgttgaggttcgtcgttttcttccaaacgccg 37326268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University