View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18108_low_39 (Length: 212)

Name: NF18108_low_39
Description: NF18108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18108_low_39
NF18108_low_39
[»] chr2 (1 HSPs)
chr2 (61-198)||(5574759-5574896)


Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 61 - 198
Target Start/End: Original strand, 5574759 - 5574896
Alignment:
Q  61 aatactgaaggatgtttagcttgatagtttagtgatagaaaatccatttttgttttcattctgcatcaaaggaccattacagtaagccatggtttagtga 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5574759 aatactgaaggatgtttagcttgatagtttagtgatagaaaatccatttttgttttcattctgcatcaaaggaccattacagtaagccatggtttagtga 5574858  T
Q  161 agcctgaactatatgtatatcattatatgaccttattg 198  Q
    ||||||||||||||||||||||| ||||||||||||||    
T  5574859 agcctgaactatatgtatatcatcatatgaccttattg 5574896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University