View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18108_high_21 (Length: 281)

Name: NF18108_high_21
Description: NF18108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18108_high_21
NF18108_high_21
[»] chr4 (1 HSPs)
chr4 (1-281)||(52988150-52988430)


Alignment Details
Target: chr4 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 52988430 - 52988150
Alignment:
Q  1 cagtcatggcaattgccagggacataagtcccacgggacaaaacactgccatgacaaaaatatcaacatggatactcatgatcacacttcacttggttct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  52988430 cagtcatggcaattgccagggacataagtcccacgggacaaaacactgccattacaaaaatatcaacatggatactcatgatcacacttcacttggttct 52988331  T
Q  101 cattgccatctcagtccctgtgataagaaagaaactcaacaagtcactaagcattgccattcgaaccatggttgtgaaaatctgaaagaccatggaacca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52988330 cattgccatctcagtccctgtgataagaaagaaactcaacaagtcactaagcattgccattcgaaccatggttgtgaaaatctgaaagaccatggaacca 52988231  T
Q  201 ttcatgacattcagcaccagaaatcaggttgtcattctgattttaagaagcacgagacagatgaaatatctattgacatca 281  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52988230 ttcatgacattcagcaccagaaatcaggttgtcattctgattttaagaagcacgagacagatgaaatatctattgacatca 52988150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University