View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18107_high_59 (Length: 243)

Name: NF18107_high_59
Description: NF18107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18107_high_59
NF18107_high_59
[»] chr7 (1 HSPs)
chr7 (17-236)||(4019031-4019246)


Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 4019246 - 4019031
Alignment:
Q  17 aatggctggttatgatccatgtacagaaaaatatgcagaagtttactacaataggccagatgttcaaaaagcacttcatgcaaacacaacaggcattcct 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4019246 aatggctggttatgatccatgtacagaaaaatatgcagaagtttactacaataggccagatgttcaaaaagcacttcatgcaaacacaacaggcattcct 4019147  T
Q  117 tataagtggactgcttgcaggtgaacttttcatgacacatatattcaagttatatgagtgattatttattgtacaatttaaagattggttaataattaat 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
T  4019146 tataagtggactgcttgcaggtgaacttttcatgacacatatattcaagttatatgagtgattatttattgtacaatttaaagattggttaataat---- 4019051  T
Q  217 taatcataagtttcttttca 236  Q
    ||||||||||||||||||||    
T  4019050 taatcataagtttcttttca 4019031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University