View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18106_high_7 (Length: 453)

Name: NF18106_high_7
Description: NF18106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18106_high_7
NF18106_high_7
[»] chr6 (3 HSPs)
chr6 (163-403)||(4277786-4278031)
chr6 (281-328)||(4272587-4272634)
chr6 (346-403)||(4272288-4272345)
[»] chr5 (1 HSPs)
chr5 (15-54)||(24109473-24109512)


Alignment Details
Target: chr6 (Bit Score: 117; Significance: 2e-59; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 163 - 403
Target Start/End: Complemental strand, 4278031 - 4277786
Alignment:
Q  163 actttcacaaaatagaaaaacatcatcacccttattggagccataccagtaggggtgagaatgatcgtacttacaacaagtacaagaaggtttggtgatg 262  Q
    |||||||||||||||||||||||||||||||||  ||||||||||  ||  |||||| ||||||||||||||||||||||||||||||||||||||||||    
T  4278031 actttcacaaaatagaaaaacatcatcacccttgctggagccatattagctggggtgggaatgatcgtacttacaacaagtacaagaaggtttggtgatg 4277932  T
Q  263 gtgaagagaatgatgg-----agtgtggagctgggaggatattgatgtatgtttgattgtgtgttgtgtttcggnnnnnnnagagagacatagtaagacc 357  Q
     || ||||||| | ||       ||||||||||||||||||  ||||||||||||||||||||||||||||||         ||| ||||||||||||||    
T  4277931 atggagagaataagggttgaatttgtggagctgggaggatacggatgtatgtttgattgtgtgttgtgtttcgttttttttggagggacatagtaagacc 4277832  T
Q  358 aaattccgcaacactatagtggtaggatgtctatataattgctttg 403  Q
    ||||||| ||||||||||||||||  |||||| |||||||||||||    
T  4277831 aaattccacaacactatagtggtataatgtctctataattgctttg 4277786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 281 - 328
Target Start/End: Complemental strand, 4272634 - 4272587
Alignment:
Q  281 tgtggagctgggaggatattgatgtatgtttgattgtgtgttgtgttt 328  Q
    |||||||||||||||| || ||||||||||||| ||||||||||||||    
T  4272634 tgtggagctgggaggacatggatgtatgtttgactgtgtgttgtgttt 4272587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 346 - 403
Target Start/End: Complemental strand, 4272345 - 4272288
Alignment:
Q  346 catagtaagaccaaattccgcaacactatagtggtaggatgtctatataattgctttg 403  Q
    |||||||||||| |||||||||||||||||||||||   ||||  |||||||||||||    
T  4272345 catagtaagaccgaattccgcaacactatagtggtattgtgtcactataattgctttg 4272288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 15 - 54
Target Start/End: Original strand, 24109473 - 24109512
Alignment:
Q  15 tagcatagggcaacgttcgataaagggtgggagacttaaa 54  Q
    ||||||||||| ||||||||||||||||||||||||||||    
T  24109473 tagcatagggcgacgttcgataaagggtgggagacttaaa 24109512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University