View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18105_high_18 (Length: 206)

Name: NF18105_high_18
Description: NF18105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18105_high_18
NF18105_high_18
[»] chr5 (2 HSPs)
chr5 (18-189)||(15854727-15854900)
chr5 (121-157)||(29032071-29032107)
[»] chr3 (1 HSPs)
chr3 (120-160)||(25868924-25868964)


Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 15854900 - 15854727
Alignment:
Q  18 agctcccacattgcatgatgagtttttatttttacagttagtg--atgtagacaaaatgacaaacatcacttaaatctgacatacgtcggatatggtggt 115  Q
    ||||||||||||||||||||||||||||||||||||||| |||  ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||    
T  15854900 agctcccacattgcatgatgagtttttatttttacagtttgtgtgatgtagacaaaatgacaaacaccacttaaatctgacatacgtcggatatggcggt 15854801  T
Q  116 gtcatatgtcggatttttggctttccgccatcgataatattgcttagtgttctgctttacttatctggattctg 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15854800 gtcatatgtcggatttttggctttccgccatcgataatattgcttagtgttctgctttacttatctggattctg 15854727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 157
Target Start/End: Complemental strand, 29032107 - 29032071
Alignment:
Q  121 atgtcggatttttggctttccgccatcgataatattg 157  Q
    ||||||||| |||||||||||||||||||||| ||||    
T  29032107 atgtcggatctttggctttccgccatcgataacattg 29032071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 25868964 - 25868924
Alignment:
Q  120 tatgtcggatttttggctttccgccatcgataatattgctt 160  Q
    ||||||||||||||||||||||||||| ||||| |||||||    
T  25868964 tatgtcggatttttggctttccgccattgataacattgctt 25868924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University