View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1809_low_51 (Length: 230)

Name: NF1809_low_51
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1809_low_51
NF1809_low_51
[»] chr3 (1 HSPs)
chr3 (26-141)||(42200332-42200448)
[»] chr4 (1 HSPs)
chr4 (25-88)||(49361028-49361091)


Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 26 - 141
Target Start/End: Original strand, 42200332 - 42200448
Alignment:
Q  26 ttggatgctccctagcatgtgacgggttagtatctttttaccaattccggattcgtcttgtgtggaattggaactaatgaaattttattagccgat-aat 124  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  42200332 ttggatgctccctagcatgtgacgggtcagtatctttttaccaattccggattcgtcttgtgtggaattggaactaatgaaattttattagccgataaat 42200431  T
Q  125 aaagaactttgaatgtc 141  Q
    |||||||||||||||||    
T  42200432 aaagaactttgaatgtc 42200448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 25 - 88
Target Start/End: Complemental strand, 49361091 - 49361028
Alignment:
Q  25 cttggatgctccctagcatgtgacgggttagtatctttttaccaattccggattcgtcttgtgt 88  Q
    |||||||||||||||||||||||||||| | |||||||||| ||||||||||||| ||||||||    
T  49361091 cttggatgctccctagcatgtgacgggtcaatatctttttagcaattccggattcatcttgtgt 49361028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University