View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1809_high_57 (Length: 211)

Name: NF1809_high_57
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1809_high_57
NF1809_high_57
[»] chr3 (1 HSPs)
chr3 (14-193)||(2108885-2109063)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 2108885 - 2109063
Alignment:
Q  14 aaatagataaaacaaaaaagaagctaatttaaccagatttgtaaataaacagaagggttaaataagtttttagttcttattataaatataacgaatttta 113  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||    
T  2108885 aaatagataaaacaaaaaagaagctactttaaccagatttgtaaataaacagatgagttaaataagtttttagttcttattataaatataacgaatttta 2108984  T
Q  114 tagggatcaaaacataacagnnnnnnnnatgaggactaaaacgaaattgattatatttatagaacaaggagaaccgggag 193  Q
    |||||||||||||||  |||        || ||||||||||||||||||||||||||||||||||||| |||||||||||    
T  2108985 tagggatcaaaacatgtcag-tttttttataaggactaaaacgaaattgattatatttatagaacaagcagaaccgggag 2109063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University