View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1809_high_49 (Length: 223)

Name: NF1809_high_49
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1809_high_49
NF1809_high_49
[»] chr5 (1 HSPs)
chr5 (108-208)||(12298658-12298755)


Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 108 - 208
Target Start/End: Original strand, 12298658 - 12298755
Alignment:
Q  108 ctattgattaacagtagcactgttattttacttccttagaaattaacaaagaattattataagagtacatgtgagcaataattaaaagagattgacataa 207  Q
    |||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||   |||||||||||||||||||||    
T  12298658 ctattgtttaacagtagcactggtattttacttccttagaaattagcaaagaattattataagagtacatgtgagc---aattaaaagagattgacataa 12298754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University