View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1809_high_31 (Length: 255)

Name: NF1809_high_31
Description: NF1809
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1809_high_31
NF1809_high_31
[»] chr5 (2 HSPs)
chr5 (99-154)||(489108-489163)
chr5 (1-65)||(489052-489112)


Alignment Details
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 99 - 154
Target Start/End: Original strand, 489108 - 489163
Alignment:
Q  99 aaatgaaagaaactagtagttttgttgacctggactataagctccaatcagtgtgt 154  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  489108 aaatgaaagaaactagtagttttgttgacctggactataagctccaatcagtgtgt 489163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 489052 - 489112
Alignment:
Q  1 atattttgaatattatagtactcagcaagaatatataagaaattaagctaaaggattttgaaatg 65  Q
    |||||||||||||||||||||| ||||||||||    ||||||||||||||||||||||||||||    
T  489052 atattttgaatattatagtactaagcaagaata----agaaattaagctaaaggattttgaaatg 489112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University