View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1809R-Insertion-25 (Length: 144)

Name: NF1809R-Insertion-25
Description: NF1809R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1809R-Insertion-25
NF1809R-Insertion-25
[»] chr8 (1 HSPs)
chr8 (7-64)||(8645834-8645891)
[»] chr3 (1 HSPs)
chr3 (82-121)||(26279311-26279350)


Alignment Details
Target: chr8 (Bit Score: 54; Significance: 2e-22; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 8645834 - 8645891
Alignment:
Q  7 cagttctaattgcatttccaaacttgcttgagtgtgccttttgggcatatccacagta 64  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  8645834 cagttctaattgcattttcaaacttgcttgagtgtgccttttgggcatatccacagta 8645891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 28; Significance: 0.0000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 82 - 121
Target Start/End: Original strand, 26279311 - 26279350
Alignment:
Q  82 aaaaaattatagctcaataatactactaactactactcca 121  Q
    |||||||||||||||| || ||||||||| ||||||||||    
T  26279311 aaaaaattatagctcagtagtactactaaatactactcca 26279350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University