View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18097_low_19 (Length: 222)

Name: NF18097_low_19
Description: NF18097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18097_low_19
NF18097_low_19
[»] chr7 (2 HSPs)
chr7 (15-129)||(33590575-33590694)
chr7 (136-205)||(33589615-33589684)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 15 - 129
Target Start/End: Complemental strand, 33590694 - 33590575
Alignment:
Q  15 atgaatgaggataaatccgctacggacgaatctattata-----atccaaaataatacactaattcaattttttagattaattaattaatggatggatag 109  Q
    ||||||||| |||||||| ||||||||||||||||||||     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33590694 atgaatgagaataaatcctctacggacgaatctattatattataatccaaaataatacactaattcaattttttagattaattaattaatggatggatag 33590595  T
Q  110 atatatctccgtaacatttt 129  Q
    |||||| ||| |||||||||    
T  33590594 atatatgtccttaacatttt 33590575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 136 - 205
Target Start/End: Complemental strand, 33589684 - 33589615
Alignment:
Q  136 ggggactcggcttctttaaagttctgtattattcaaagttacagggtcaggaaatctagtgattccttag 205  Q
    ||||| || |||||||||||||| || |||||| |||||||||||||||||||||||| |||||||||||    
T  33589684 ggggattcagcttctttaaagttatggattattaaaagttacagggtcaggaaatctaatgattccttag 33589615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University