View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18097_low_18 (Length: 250)

Name: NF18097_low_18
Description: NF18097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18097_low_18
NF18097_low_18
[»] chr3 (3 HSPs)
chr3 (19-114)||(18346543-18346638)
chr3 (182-229)||(18346446-18346493)
chr3 (140-196)||(18321318-18321374)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 18346638 - 18346543
Alignment:
Q  19 actacataaacacaaaatttcagagtttagtacagataaaaagcttaaaagcagaattgtgtttcttagagaatactataaatcaaggctgcatat 114  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18346638 actacataaacacaaaatttcagagtttagtacaaataaaaagcttaaaagcagaattgtgtttcttagagaatactataaatcaaggctgcatat 18346543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 182 - 229
Target Start/End: Complemental strand, 18346493 - 18346446
Alignment:
Q  182 attattccattatggaagaatctccttagtcttaaccaatgatgctaa 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  18346493 attattccattatggaagaatctccttagtcttaaccaatgatgctaa 18346446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 18321374 - 18321318
Alignment:
Q  140 tttttattacgtgttcattgaaaaagactgaagttacataatattattccattatgg 196  Q
    |||||||||| |||||||||||||||||| |||||||| |||||||||| |||||||    
T  18321374 tttttattacatgttcattgaaaaagactaaagttacacaatattattctattatgg 18321318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University