View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1808_low_12 (Length: 254)

Name: NF1808_low_12
Description: NF1808
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1808_low_12
NF1808_low_12
[»] chr7 (1 HSPs)
chr7 (152-216)||(7796335-7796400)
[»] chr4 (1 HSPs)
chr4 (27-109)||(54292994-54293075)


Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 152 - 216
Target Start/End: Original strand, 7796335 - 7796400
Alignment:
Q  152 taaacacaagagcaatgctttttg-gcaacaaattttagacaacttctgcaacaacattttcaatg 216  Q
    |||||| ||||| ||||||||||  |||||||||||||||||||||||||||||||||||| ||||    
T  7796335 taaacaaaagagaaatgctttttccgcaacaaattttagacaacttctgcaacaacattttaaatg 7796400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 27 - 109
Target Start/End: Original strand, 54292994 - 54293075
Alignment:
Q  27 gtttgtctaagaagcagactttgaagataaaaggtggagaggaagaatagatgaattagaggatgagggaaataagagctgca 109  Q
    |||||||||||||| || |||||||||| ||||||| |||||||||||  | || ||| |||||||||| |||||||||||||    
T  54292994 gtttgtctaagaagaaggctttgaagatcaaaggtgaagaggaagaatcaacgagttaaaggatgaggg-aataagagctgca 54293075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University