View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18078_low_53 (Length: 261)

Name: NF18078_low_53
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18078_low_53
NF18078_low_53
[»] chr1 (1 HSPs)
chr1 (19-250)||(33536257-33536491)
[»] chr8 (1 HSPs)
chr8 (179-211)||(38078205-38078237)


Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 33536257 - 33536491
Alignment:
Q  19 ttgtcacgttcatttttcttgtattatatcatatttttccaattattttgatgatcataactttatgagatgatatgatgattagtttagttggtaaata 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  33536257 ttgtcacgttcatttttcttgtattatatcatatttttccaattattttgatgatcataactttatgagatgaaatgatgattagtttagttggtaaata 33536356  T
Q  119 ggtaatgtgattg---ataatgccgttcatttgttagcaacgtcgtcattgtcgtacgctagcttccaaatttatgatcatatgtcatcttgtattatga 215  Q
    |||||||||||||   ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||    
T  33536357 ggtaatgtgattgataataatgccgttcatttgttagcaacgttgtcattgtcgtatgctagcttccaaatttatgatcatatgtcatcttatattatga 33536456  T
Q  216 ccgaagatctattgtatgattgatattattatttt 250  Q
    |||||||||||||||||||||||||||||||||||    
T  33536457 ccgaagatctattgtatgattgatattattatttt 33536491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 179 - 211
Target Start/End: Complemental strand, 38078237 - 38078205
Alignment:
Q  179 ttccaaatttatgatcatatgtcatcttgtatt 211  Q
    ||||||||| |||||||||||||||||||||||    
T  38078237 ttccaaattcatgatcatatgtcatcttgtatt 38078205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University