View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18078_high_64 (Length: 226)

Name: NF18078_high_64
Description: NF18078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18078_high_64
NF18078_high_64
[»] chr2 (1 HSPs)
chr2 (12-210)||(4885203-4885401)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 210
Target Start/End: Original strand, 4885203 - 4885401
Alignment:
Q  12 agcatagggagggacaacaacgatcttaggaacaactccgccatcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatg 111  Q
    ||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4885203 agcatcgggagggacaacaacgatcttaggaacaacaccgccatcttgtgttgaaggtgaagaaggtttcttgagaacatgttttgggtatgttttcatg 4885302  T
Q  112 atttcacttgctttgatgctgccactgatttcttctactcgaccgttgcagtgtactatacggatcacatcaagtgctccacatggtagaatgcaagat 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4885303 atttcacttgctttgatgctgccactgatttcttctactcgaccgttgcagtgtactatacggatcacatcaagtgctccacatggtagaatgcaagat 4885401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University