View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18077_low_25 (Length: 366)

Name: NF18077_low_25
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18077_low_25
NF18077_low_25
[»] chr4 (3 HSPs)
chr4 (1-115)||(26502392-26502510)
chr4 (310-350)||(26502033-26502073)
chr4 (149-212)||(26502328-26502391)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 5e-38; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 26502510 - 26502392
Alignment:
Q  1 tgagattacgatgtcaacttgctttatgaccttaaccaaactctgatggtcgtatatatcaccctgt---caaaaaatcaacatcaattattaagactta 97  Q
    ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||| ||    
T  26502510 tgagattacgatgtccacttgctttatcaccttaaccaaactctgatggtcgtatatatcaccctgtaaaaaaaaaatcaacatcaattattaagaccta 26502411  T
Q  98 cc-ataaataccaaacaac 115  Q
    || ||||||||||||||||    
T  26502410 ccaataaataccaaacaac 26502392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 310 - 350
Target Start/End: Complemental strand, 26502073 - 26502033
Alignment:
Q  310 attattatctttagttattatagacttaatagtcaaaatat 350  Q
    |||||||||||||||||||||| ||||||||||||||||||    
T  26502073 attattatctttagttattataaacttaatagtcaaaatat 26502033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 26502391 - 26502328
Alignment:
Q  149 aataattatgaggctataattgttggcaagaaaattgcagtcttgttcaaaagaagaaaattgt 212  Q
    |||||||||||||||| |||| |||| ||||||||||  || |||||||||| |||||||||||    
T  26502391 aataattatgaggctacaattattgggaagaaaattgttgttttgttcaaaaaaagaaaattgt 26502328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University