View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18077_high_46 (Length: 256)

Name: NF18077_high_46
Description: NF18077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18077_high_46
NF18077_high_46
[»] chr5 (2 HSPs)
chr5 (115-249)||(42801847-42801982)
chr5 (14-116)||(42801718-42801820)


Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 115 - 249
Target Start/End: Original strand, 42801847 - 42801982
Alignment:
Q  115 caatacttaatgatatcgttttgctagacaatcatgaggaaatttttcgcatttcgannnnnnnn-actagtttataacatatttttataagatacttca 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||| ||||| ||||||||||||    
T  42801847 caatacttaatgatatcgttttgctagacaatcatgaggaaatttttcgcatttcgatttttttttactagtttataacatttttttttaagatacttca 42801946  T
Q  214 actaccgttttaatttataactcagatttcttctca 249  Q
    |||||||||| |||||||||||||||||||||||||    
T  42801947 actaccgtttgaatttataactcagatttcttctca 42801982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 14 - 116
Target Start/End: Original strand, 42801718 - 42801820
Alignment:
Q  14 aaaattacatatgacatagaatgtatctaacgaaatccgacatcagggtcattgcaaaataacacacgtccaaatttcataacaaacgagataaaagatt 113  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||    
T  42801718 aaaattacatatgacatagaatgtatctaacgaaatccgaaatcagggtcattgcaaaattacacacgtccaaatttcataacaaacgaaataaaagatt 42801817  T
Q  114 gca 116  Q
    |||    
T  42801818 gca 42801820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University