View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18072_high_23 (Length: 212)

Name: NF18072_high_23
Description: NF18072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18072_high_23
NF18072_high_23
[»] chr1 (3 HSPs)
chr1 (10-117)||(45122166-45122273)
chr1 (103-160)||(45122028-45122085)
chr1 (155-189)||(45121965-45121999)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 10 - 117
Target Start/End: Complemental strand, 45122273 - 45122166
Alignment:
Q  10 agtgagatgaacttagtattgatttataatatcaacactcgggcacttgaatattgctcaaaaagaatgttagtgtagagattttattaccgagtaaaaa 109  Q
    ||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  45122273 agtgagaagaacttagcattgatttataatatcaacactcggccacttgaatattgctcaaaaagaatgttagtgtagagattttattactgagtaaaaa 45122174  T
Q  110 atatgtat 117  Q
    ||||||||    
T  45122173 atatgtat 45122166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 45122085 - 45122028
Alignment:
Q  103 gtaaaaaatatgtattcagtgtctgatgcaaaaactatttatactatattttttataa 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45122085 gtaaaaaatatgtattcagtgtctgatgcaaaaactatttatactatattttttataa 45122028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 155 - 189
Target Start/End: Complemental strand, 45121999 - 45121965
Alignment:
Q  155 ttataagcccaacattttttacccttgatcattct 189  Q
    |||||||||||||||||||||||||||||||||||    
T  45121999 ttataagcccaacattttttacccttgatcattct 45121965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University