View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18071_low_47 (Length: 344)

Name: NF18071_low_47
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18071_low_47
NF18071_low_47
[»] chr3 (2 HSPs)
chr3 (166-326)||(38908420-38908576)
chr3 (61-101)||(38908598-38908638)
[»] scaffold0130 (1 HSPs)
scaffold0130 (1-75)||(21780-21854)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 9e-58; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 166 - 326
Target Start/End: Complemental strand, 38908576 - 38908420
Alignment:
Q  166 atattgatgatctcactattataattcacttgtatacctttttaatttatggaccaatgaattttaagaatgagattaccaacataacaccctaatgcca 265  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||     ||||| |    
T  38908576 atattgatgatctcactattataattcacttgtatacctttttaatttgtggaccaatgaattttaagaatgagattaccaacataac-----aatgcaa 38908482  T
Q  266 cataagagaatacagattggatctttactcttaatacataaagagca-ccccaaattgggaa 326  Q
    ||| ||||||||||||||||||||||||||||  ||||||||||||| ||||||||||||||    
T  38908481 catcagagaatacagattggatctttactctttgtacataaagagcacccccaaattgggaa 38908420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 61 - 101
Target Start/End: Complemental strand, 38908638 - 38908598
Alignment:
Q  61 tacaacatttctaacaatctgtgatatctgattcagaaaac 101  Q
    |||||||||||||||||||| ||||||||||||||||||||    
T  38908638 tacaacatttctaacaatctttgatatctgattcagaaaac 38908598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0130 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: scaffold0130
Description:

Target: scaffold0130; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 21854 - 21780
Alignment:
Q  1 aaaatattggaaaactgaaattttggagacatgtcaaagcattaaaataataaagaaggttacaacatttctaac 75  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  21854 aaaatattggaaaactcaaattttggagacatgtcaaagcattaaaataataaagaaggttaaaacatttctaac 21780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University