View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18071_low_103 (Length: 219)

Name: NF18071_low_103
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18071_low_103
NF18071_low_103
[»] chr3 (1 HSPs)
chr3 (17-202)||(38935878-38936063)


Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 38935878 - 38936063
Alignment:
Q  17 agaggatgttaaggtttgggtggaagaaaagatgctggttgtgaaagctgagaaagcacctaagaagaagaatgatgaagatgaagaatggtctaagagc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38935878 agaggatgttaaggtttgggtggaagaaaagatgctggttgtgaaagctgagaaagcacctaagaagaagaatgatgaagatgaagaatggtctaagagc 38935977  T
Q  117 tatggtaggtatagtagcagaattgctttgccagagaatgtgcagtttgagaatattaaggctgaggttaaggatggtgttcttta 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38935978 tatggtaggtatagtagcagaattgctttgccagagaatgtgcagtttgagaatattaaggctgaggttaaggatggtgttcttta 38936063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University