View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18071_high_86 (Length: 236)

Name: NF18071_high_86
Description: NF18071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18071_high_86
NF18071_high_86
[»] chr3 (1 HSPs)
chr3 (12-133)||(38861903-38862025)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 12 - 133
Target Start/End: Complemental strand, 38862025 - 38861903
Alignment:
Q  12 cacagattagtcaggtttggcatgcttcctaatactgatttcggtaccaaactcaatcctaccnnnnnnn-ttataggttttggaatgacataaaatcaa 110  Q
    ||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||    
T  38862025 cacagattagtcatgtttggtatgcttcttaatactgatttcggtaccaaactcaatcctaccaaaaaaaattataggttttggaatgacataaaatcaa 38861926  T
Q  111 ttatcaaattttcattaatgtat 133  Q
    |||||||||||||||||||||||    
T  38861925 ttatcaaattttcattaatgtat 38861903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University