View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1806_high_13 (Length: 203)

Name: NF1806_high_13
Description: NF1806
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1806_high_13
NF1806_high_13
[»] chr4 (1 HSPs)
chr4 (16-185)||(40586728-40586896)


Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 16 - 185
Target Start/End: Complemental strand, 40586896 - 40586728
Alignment:
Q  16 aaaatcaaatttagctagcatcaaaacttaaacctatnnnnnnnncaaaatgtttactctcataatattggaacaccatttgctagaaaagaaaatgaag 115  Q
    |||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40586896 aaaatcaaatttagctagcatcaaaacttaaacctataaaaaaa-caaaatgtttactctcataatattggaacaccatttgctagaaaagaaaatgaag 40586798  T
Q  116 gtgaaaaatagttgcgtttctttcacatagcatatatagcatctctttagtccatttctttttagtgtac 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40586797 gtgaaaaatagttgcgtttctttcacatagcatatatagcatctctttagtccatttctttttagtgtac 40586728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University