View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18069_low_6 (Length: 204)

Name: NF18069_low_6
Description: NF18069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18069_low_6
NF18069_low_6
[»] chr5 (1 HSPs)
chr5 (10-189)||(13766992-13767169)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 189
Target Start/End: Original strand, 13766992 - 13767169
Alignment:
Q  10 ggtacattatactgacttgaaaaagttatttatgtgaatatctttgacatatgttattgatattatatagtttacctagatagtatgaaatatatggatt 109  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  13766992 ggtacattataatgacttgaaaaagttatttatgtgaatatctttgacatatgttattgatattatatagtttacctagatagtatgaaatatatggaat 13767091  T
Q  110 atgttctcaaactctgttcaaatcatgtttcatataaccaccaacttttggcctctttagctgcaaacttcaatgttact 189  Q
    |||||||||||||| ||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||    
T  13767092 atgttctcaaactcagttcaaatcatgtttc--ataaccaccaacttttggcctctttagctgcaaacttcaatgttact 13767169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University