View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18068_high_97 (Length: 242)

Name: NF18068_high_97
Description: NF18068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18068_high_97
NF18068_high_97
[»] chr8 (1 HSPs)
chr8 (119-209)||(39994494-39994584)


Alignment Details
Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 119 - 209
Target Start/End: Complemental strand, 39994584 - 39994494
Alignment:
Q  119 ccctaaatctcaatctctattcattgaagcaccggacaatttcatcattcctaatcgatcgtcgatttctcgttgtttcttcgtgttttca 209  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39994584 ccctaaatctcaatctctattcattgaagcaccgcacaatttcatcattcctaatcgatcgtcgatttctcgttgtttcttcgtgttttca 39994494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University