View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18067_low_10 (Length: 215)

Name: NF18067_low_10
Description: NF18067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18067_low_10
NF18067_low_10
[»] chr7 (1 HSPs)
chr7 (18-197)||(47462057-47462236)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 47462236 - 47462057
Alignment:
Q  18 caaccgccccgttattgtcggatatatcgacaatacttcagacaatgattctctcaacgggtccaactcaaatgatccaaaccatttttcttcatttttg 117  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47462236 caaccggcccgttattgtcggatatatcgacaatacttcagacaatgattctctcaacgggtccaactcaaatgatccaaaccatttttcttcatttttg 47462137  T
Q  118 taatagtatatcaaatgcagtgtatgataactcataccatggtctacacccgtcaacttgtgggtcttacccgaactcac 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  47462136 taatagtatatcaaatgcagtgtatgataactcataccatggtctacacccgtcaacttgtggctcttacccgaactcac 47462057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University