View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18065_low_31 (Length: 285)

Name: NF18065_low_31
Description: NF18065
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18065_low_31
NF18065_low_31
[»] chr3 (1 HSPs)
chr3 (18-273)||(45173528-45173783)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 18 - 273
Target Start/End: Original strand, 45173528 - 45173783
Alignment:
Q  18 acataaaactgaaatatcccttcctcaggtttatatgtcccaagataacactttaaacacttttcgtgaaaggggaaaaataaaacaggataggtccaaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  45173528 acataaaactgaaatatcccttcctcaggtttatatgtcccaagataacactttaaacacttttcgtgaaaggggaaaaataaaacaggatagctccaaa 45173627  T
Q  118 ctttttatcccttaacnnnnnnnnnctccatactttttaaggcatttccaatttgctagaaagcaaaatttagtgcatgtttgtatttactgcgagttta 217  Q
    ||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45173628 ctttttatcccttaacaaaaaaaaactccatactttttaaggcatttccaatttgctagaaagcaaaatttagtgcatgtttgtatttactgcgagttta 45173727  T
Q  218 accaaattactgtgtgacaaatcaacaatgtagatttgacaaaaactatacacctt 273  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45173728 acaaaattactgtgtgacaaatcaacaatgtagatttgacaaaaactatacacctt 45173783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University