View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18062_low_14 (Length: 222)

Name: NF18062_low_14
Description: NF18062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18062_low_14
NF18062_low_14
[»] chr1 (1 HSPs)
chr1 (19-206)||(23434002-23434189)


Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 206
Target Start/End: Original strand, 23434002 - 23434189
Alignment:
Q  19 gtatgttagatttatgaacctggaaagagaagggaaagaaaactctttcacagtatggctaggttagatgtcaataaccgcaagagaaagcgttgcttgt 118  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23434002 gtatgttagatttatgaacctggaaagagaagggaaagagaactctttcacagtatggctaggttagatgtcaataaccgcaagagaaagcgttgcttgt 23434101  T
Q  119 ttggctcatgccgcatccttcgacttttctggagaccatgnnnnnnnnaatgaatgtttcttaccttgggatgtttatcataaaaaac 206  Q
    ||||||||| |||||||||||| ||||||| |||||||||        ||||||||||||||||||||||||||||||||||||||||    
T  23434102 ttggctcataccgcatccttcggcttttctagagaccatgttttttttaatgaatgtttcttaccttgggatgtttatcataaaaaac 23434189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University