View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18058_low_42 (Length: 231)

Name: NF18058_low_42
Description: NF18058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18058_low_42
NF18058_low_42
[»] chr6 (2 HSPs)
chr6 (29-110)||(31832628-31832709)
chr6 (170-223)||(31832515-31832568)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 29 - 110
Target Start/End: Complemental strand, 31832709 - 31832628
Alignment:
Q  29 tgatccaccaatccaatcctacccatcaaatcctcagcttcagttttcattcagaagactctttcacatcaccccattaaaa 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31832709 tgatccaccaatccaatcctacccatcaaatcctcagcttcagttttcattcagaagactctttcacatcaccccattaaaa 31832628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 170 - 223
Target Start/End: Complemental strand, 31832568 - 31832515
Alignment:
Q  170 aactacaacaatacttgaactacgtggtgtcaagaacaatgatggtgatgatga 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31832568 aactacaacaatacttgaactacgtggtgtcaagaacaatgatggtgatgatga 31832515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University