View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18054_low_67 (Length: 247)

Name: NF18054_low_67
Description: NF18054
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18054_low_67
NF18054_low_67
[»] chr5 (1 HSPs)
chr5 (10-247)||(8907776-8908013)


Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 10 - 247
Target Start/End: Original strand, 8907776 - 8908013
Alignment:
Q  10 aagaaaatcaagaaggnnnnnnnctattgtgttaacctgttccacaattttttggctatttggtgcattgcactttccaaggatgaaatgtccgcaattt 109  Q
    ||||||||||||||||       ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8907776 aagaaaatcaagaaggaaaaaaactattgtgttaacctattccacaattttttggctatttggtgcattgcactttccaaggatgaaatgtccgcaattt 8907875  T
Q  110 tccaccggatcaccataacttgcaaaatccactcgagtaattgttttgctgtccaaacacaccaagtttgctgctggttttggggtgtccacattggtcc 209  Q
     |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8907876 cccaccggatcaccataacttgcaaaatccacttgagtaattgttttgttgtccaaacacaccaagtttgctgctggttttggggtgtccacattggtcc 8907975  T
Q  210 ttatcacacctttatatctgctcaatgtctcaacattt 247  Q
    ||||||||||||||||||||||| ||||||||||||||    
T  8907976 ttatcacacctttatatctgctccatgtctcaacattt 8908013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University